Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRH244
Clone ID RRH244
Vector pGT0Lxf
Project baygenomics

Sequence tag RRH244
Sequence
CAGAGCAGCCAAGATGGCCGACTTTGAGGATCGGGTGTCGGATGAAGAGA
Sequence Type mRNA
Unitrap ID UNI7212 UNI7213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104667260..104667309 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070372 (Capza1) NM_009797 capping protein (actin filament) muscle Z-line, alpha 1 Gene [Source:MGI (curated);Acc:Capza1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 107352547..107352596 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067017 (AC124553.4)  

 
Come back to gene ENSMUSG00000067017


For any suggestions or comments, please send an email to unitrap@crg.es