Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST96078
Clone ID OST96078
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST96078
Sequence
TGAGAGATGGTTTAAAGCTTGAAACTGAATTACTGGATGGAAAAACCAAGTTAATACTGTCCCCATATGGTATGCTGTGT
TTTTGGACGTCGAAAATGTTTGTATGTAGACTATGTGGTAGTTTAATAGATGTTTGTTTTGCTTGTATAGTTAAATGACA
CTTGGAAAAAGCCTCTTTTTAATGTCTACAAATTGATATTTATCCAAGTAAAGTCAGATTGTGACAGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI23386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 28319676..28319903 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046753 (Ccdc66) NM_177111 coiled-coil domain containing 66 Gene [Source:MGI Symbol;Acc:MGI:2443639]

 
Come back to gene ENSMUSG00000046753


For any suggestions or comments, please send an email to unitrap@crg.es