Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST95986
Clone ID OST95986
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST95986
Sequence
GTCCTTGTGATTGCCTTGCTCACTTGCTCTGTGACTGCTTATCCCAATGGCAAAGTACCAATGTCCTGCGGNGGGNTNNT
CCCCCAACNTAACCACAGCCNACCAGTCTGNGCNTNTTCACCAAATACACAGTAGAGTCGAGNCTNACGGTCANACCTGG
AAACNAATGNGNAGATGNTNTATNNNGANCNCCCNNAAGANNNNTNGNTNAANGNACTTCCTGGATGCTGCCAATTAGAG
CCNGCCTGCNNTNGGCTNCTTCACTCTGATTGACAGCGAAGAGTCACAGCTTCTGACCTGTACCGATGTACAGGGATTAG
CTGTGAGTCATACAAGGTCATCCAAGAAGACAGAAATTAAAGTCTACTGGGATGCTCCAAGCCCTGCCCCAGATCACATA
CGATTTCTAGCTACAGTTGTTTCAGAAATTTAAAATCTACTGGGTGAAGAT
Sequence Type mRNA
Unitrap ID UNI23891

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116581200..116586008 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033386 (Frrs1) NM_009146 ferric-chelate reductase 1 Gene [Source:MGI Symbol;Acc:MGI:108076]

 
Come back to gene ENSMUSG00000033386


For any suggestions or comments, please send an email to unitrap@crg.es