Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRH302
Clone ID RRH302
Vector pGT0Lxf
Project baygenomics

Sequence tag RRH302
Sequence
CCAACCAGCTTCAGTAACTTGTGATTGGTGGTTGGCTATCCAGTTGTTCATCCTCACATCAATGCACTGCCAAT
Sequence Type mRNA
Unitrap ID UNI7052

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22047862..22047929 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es