Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRH305
Clone ID RRH305
Vector pGT0Lxf
Project baygenomics

Sequence tag RRH305
Sequence
GGCTCCGGCCAGGAGAAGTACCGGCTCGTGGTGGTCGGCGGTGGCGGCGTGGGCAAGTCGGCGCTCACCATCCAGTTCAT
CCAGTCCTATTTTGTGACGGACTATGATCCAACCATTGAAGACTCATACACAAAGCAATGTGTGATCGATGACCGAGCTG
CCCGGCTGGACATTTTGGATACAGCCGGACAAGAGGAGTTTGGAGCCATGAGAGAGCAATACATGAGGACAGGCGAGGGC
TTCCTGTTGGTCTTCTCAGTCACGGATAGAGGCAGTTTTGAAGAAATCTATAAGTTTCAAAGACAGATTCTCAGAGTAAA
GGACCGTGATGAGTTTCCCATGATTTTAATTGGCAATAAAGCTGACCTGGACCATCAGAGA
Sequence Type mRNA
Unitrap ID UNI8196

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 121202057..121260993 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055723 (Rras2) NM_025846 related RAS viral (r-ras) oncogene homolog 2 Gene [Source:MGI Symbol;Acc:MGI:1914172]

 
Come back to gene ENSMUSG00000055723


For any suggestions or comments, please send an email to unitrap@crg.es