Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST94637
Clone ID OST94637
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST94637
Sequence
CAGAAGACATCCCACCACATGGNCCCTGTGTTTGTCCTGATGAGCGCCTGCCTGGCCACCGCAGGTAATGCACCTTCTCA
ATTGGGAGGCTCTTAACCTTCTCTTGAATTCCTATTTCCTTCTCCCCTCAGTCTCTTTGGCTAAAAATATTTAGTCCATA
TTATCTTATGTAAAATGTGAATATTTATGTTATTTAGGTAAATAAAATATTTGACTATCATACTGATACATAAAAAAAT
Sequence Type mRNA
Unitrap ID UNI26816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107695044..107695271 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029287 (Tgfbr3) NM_011578 transforming growth factor, beta receptor III Gene [Source:MGI (curated);Acc:Tgfbr3-001]

 
Come back to gene ENSMUSG00000029287


For any suggestions or comments, please send an email to unitrap@crg.es