Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI014
Clone ID RRI014
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI014
Sequence
GCAAGATGCTGAATGCGAGAGAGCCCAAGGTGGTCAATGGGCCAGAAATCCTTAACAAGTATGTGGGAGAATCAGAGGCT
AACATTCGTAAACTCTTTGCTGATGCCGAAGAGGAGCAAAGGAGGCTTGGTGCTAACAGTGGCTTGCACATCATCATCTT
TGATGAAATCGATGCCATCTGCAAGCAGAGAGGGAGCATGGCCGGCAGCACTGGAGTGCATGACACCGTGGTCAACCAGC
TGCTGTCCAAGATCGATGGCGTTGAGCAGCTGAACAACATCCTCGTTATCGGAATGACCAATAGACCAGATTTGATAGAC
GAAGCTCTCCTTCGACCCGGAAGACTGGAAGTTAAAATGGAGATAGGCTTGCCAGATGAGAAGGGTCGACTCCAGATCCT
TCATATCCACACAGCAAGGATGAGAGGGCACCAGTTACTGTCTGCAGATGTGGACATCAAGGAGCTGGCTGTGGA
Sequence Type mRNA
Unitrap ID UNI4543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103733552..103744180 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es