Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI015
Clone ID RRI015
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI015
Sequence
AGTTTGGGATCACCTGATCAGAGCGTGAGGCAGAAATGGCGTCTTCCTTGCTTGCCGGCGAACGACTGGTTCGCGCTTTG
GGTCCTGGCGGAGAACTGGAACGGGAGCAGCTCCCCCGGAAGCTGCGTGCCCAGCTCGAGGCTGCTCTGGGAAAGAAACA
CGCGGGCAGTGATAATGCCACGGGACCCCGGCGCCTGGTTTCATTCCGTCTCATCCGAGATCTGCATCAGCACCTGAGAG
AAAGAAATTCCAGGCTGTATCTTCATGAACTCCTAGAAGGCAGTGACATCTACTTTCCAGAGATTGTGAAGCCTCCCCG
Sequence Type mRNA
Unitrap ID UNI8204

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78323851..78325644 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051232 (Tmem199) NM_199199 transmembrane protein 199 Gene [Source:MGI (curated);Acc:Tmem199-001]

 
Come back to gene ENSMUSG00000051232


For any suggestions or comments, please send an email to unitrap@crg.es