Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST93088
Clone ID OST93088
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST93088
Sequence
GACTGAGGATATGGTTTTGGCAGGGAAAACATTGCCGATTGAGGTGTACTGCCATCTTCCAGTTCTGTGCGAGGACCAGA
ACTTGCCCTACGTCTACATCCCCTCTAAGACGGACTTGGGTGCAGCCACAGGCTCCAAGCGTCCCACTTGTGTGATCATG
GTGAAGCCCCATGAAGAATATCAGGAGACCTACGACAAGTGCCTGGAGGAGGTGCAGGCACTGCCTACACCTCTGTGAGA
GACTTGGGCTGCAACCCAGCCCCTTTCCAAGAGATCTGGCTGGCTGCAGGCAGCTGCCCACCCTAACAGCATCTCCCCGA
TTTCTTGCTGTGTGAGTCTTCCCAGGCAGCTCCAGCAGTGTTGGAGGTGGAGCCTGCATCTCTGCCATCTCCTCCTGAGC
TTTGATGAAGACAGTTCCAAGAATGTGGGATAGAAGTAAATGCTAAGGCGAAAACGTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51435985..51436939 347
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001056 (Nola2) NM_026631 nucleolar protein family A, member 2 Gene [Source:MGI (curated);Acc:Nola2-001]

 
Come back to gene ENSMUSG00000001056


For any suggestions or comments, please send an email to unitrap@crg.es