Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI090
Clone ID RRI090
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI090
Sequence
GCACGCCCGTGCACTGGGCTGCGCACTTCGGCAAGTTGGAGTGCTTAATGCAGTTGGTAAGAGCAGGAGCCTCACTGAAT
GTCTCGACCACCCGCTATGCCCAGACCCCAGCCCACATCGCTGCTTTTGGAGGACATCCTCAGTGTCTGGTCTGGCTGAT
TCAAGCTGGGGCCAACATTAACAAACC
Sequence Type mRNA
Unitrap ID UNI8219

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 11632867..11635443 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031508 (Ankrd10) NM_133971 ankyrin repeat domain 10 Gene [Source:MGI Symbol;Acc:MGI:1921840]

 
Come back to gene ENSMUSG00000031508


For any suggestions or comments, please send an email to unitrap@crg.es