Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRI092
Clone ID RRI092
Vector pGT0Lxf
Project baygenomics

Sequence tag RRI092
Sequence
GCTCGTTTTGGGGGAGGTGCCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGCCGAC
TGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATAAGGGCAAGTCCTTAGAGATCCAGA
AACCCGCTGTTGCCCCTCGACATGGCCTGCAGAGTCTCGGAAAAGTTGCCATTGCCCGGCGCATGCCACCCCCAGCCAAC
CTTCCAAGCCTGAAAGCCGAGAACAAAGGCAATGACCCCAATGTCTCACTAGTGCCGAAAGACGGAACAGGATGGGCAAG
CAAACAGGAGCAGTCCGACCCCAAG
Sequence Type mRNA
Unitrap ID UNI8220

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35299149..35299985 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024393 (Bat2) NM_020027 HLA-B associated transcript 2 Gene [Source:MGI Symbol;Acc:MGI:1915467]

 
Come back to gene ENSMUSG00000024393


For any suggestions or comments, please send an email to unitrap@crg.es