Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST92776
Clone ID OST92776
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST92776
Sequence
GACTGAGGTGTTTCAATTGAAGAATGATGCCTCATATTCAACATCTGAAAGGAGCACATAGTAAGAACTTATTTCTTAAA
GACG
Sequence Type mRNA
Unitrap ID UNI16965

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29413599..29413678 72
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032673 (2010316F05Rik) NM_026465 non-protein coding RNA 117 Gene [Source:MGI Symbol;Acc:MGI:1915189]

 
Come back to gene ENSMUSG00000032673


For any suggestions or comments, please send an email to unitrap@crg.es