Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CB0251
Clone ID CB0251
Vector pGT0lxfT1
Project sanger

Sequence tag CB0251
Sequence
CCTTATTTTCGACCCATTATCTTTTCTACTTGCCCAGCGCCCGGGAGGAGAGAAGACGGGCGGCGTGCCATGGCGGTCGC
GCTCCCGGAGGTGGTGGAAGAGCTCCTGAGCGAGATGGCCGCCGCTGTGCGAGACAGCGCGAGAAGCTGGAGTTTGTGTT
TGGGTCATCGGCCATCCAGGCCTTGGACCTAGTCGATCGAGAGTCCGTCACTTTAATCTCATCACCCAGTGGAAGGCGTG
TTTACCAG
Sequence Type mRNA
Unitrap ID UNI861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62087214..62094869 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014243 (2410012H22Rik) zinc finger, SWIM-type containing 7 Gene [Source:MGI Symbol;Acc:MGI:1916997]

 
Come back to gene ENSMUSG00000014243


For any suggestions or comments, please send an email to unitrap@crg.es