Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF205
Clone ID RRF205
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF205
Sequence
CCTTCTCTTCCTGGGCTCCTCGGTGCCGCCGCCGGCTCGCTGCGCGCTCTGCTCTTCCAGCTCTGCGGACCGCAGCAGCC
ATGGCCGACATCAAGACGGGCATCTTCGCCAAAAACGTGCAAAAGCGCCTCAACCGCGCGCAGGAAA
Sequence Type mRNA
Unitrap ID UNI8224

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 19040222..19040368 147
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021314 (Amph) NM_175007 amphiphysin Gene [Source:MGI Symbol;Acc:MGI:103574]

 
Come back to gene ENSMUSG00000021314


For any suggestions or comments, please send an email to unitrap@crg.es