Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST92617
Clone ID OST92617
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST92617
Sequence
TGAGGAGGAACTGAGCAGCACAAGCGTGGGAACACATCATTGTCAACCCCAACGCTGCCTACGACAAGTTCAAGGACAAG
AGAGTGGGAACAAAGGGGCTTGATTTCTCAGATCGCATTGGAAAGACCAAGAGGACAGGATATGAGTCTGGAGACTATGA
AATGGTTTGTTGTGTGATGACCGTGGGGTGAGCCTAGAGCAGGCCTGCAGGGGAGTGAGCAGTGTTAAGTTTGGGGCTTT
GTTTCTTTATTTTAAATTTCTCTCTCTCTTATTTTTTTGGCTTTGTTTTTTGCCTTGGGGATTATTATTATTTTGGTGNG
NTTTTGTTGNTGNTT
Sequence Type mRNA
Unitrap ID UNI26827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126711768..126712282 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025410 (Dctn2) NM_027151 dynactin 2 Gene [Source:MGI Symbol;Acc:MGI:107733]

 
Come back to gene ENSMUSG00000025410


For any suggestions or comments, please send an email to unitrap@crg.es