Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST92389
Clone ID OST92389
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST92389
Sequence
GACTGAGGAGTACTCTGAAGACAGTAACTCTGAGCCCAATGTGGATTTGGAAAATCAGTACTATAATTCCAAAGCACTGA
AAGAAGATGACCCAAAAGCAGCATTAAGCAGCTTCCAAAAGGTTTTGGAGCTTGAAGGTGAGAAGGGAGAATGGGGATTC
AAAGCGCTAAAACAGATGATCAAGATTAACTTCAAGTTGACAAACTTTNCANANATGATGANCANNTANTGNCNGCTATN
GNCCTATATTCGNANCGCANGCNCCANNANCTATTCTGAANAGTNCNTNAATTCTATCCTTGATTATATCTCCACTTCTA
AACAGATGGATTTACTGCAGGAATTTTATGAAACAACACTGGAAGCTTTGAAAGATGCTAAGAATGATAGACTGTGGTTT
AAGACAAACACAAAGCTTGGAAAATTATATTTAGAACGAGAAGAATATGGAAAGCTTCAAAAAATTTTACGACAGTTACA
TCAGTCTTGTCAGACTGATGATGGAGAAGATGACCTGAAAAAGGNACCCAGTTATTAGAAAT
Sequence Type mRNA
Unitrap ID UNI16679

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 125668169..125675591 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027206 (Cops2) NM_009939 COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) Gene [Source:MGI (curated);Acc:Cops2-001]

 
Come back to gene ENSMUSG00000027206


For any suggestions or comments, please send an email to unitrap@crg.es