Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST92155
Clone ID OST92155
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST92155
Sequence
GGCTACTGGGTGGACAACGTGGNCAAGTGTGGCACCATGATCGACTTTGGCCGTGATGAGGCCCCTGAACCCACCCAGTT
CCCCATACCTAAGGTGGAGATTCTAGACCCAGATGGTGTGCTGAAGGAAGCGTTGGATAAGCTGATGAAGCCCGAGGAAG
AGGAGGGCTGAGGTNANCCGAAGCCTCTCCGTGCCCCTGAACAATGCTGACCTTCTGGTATCACTAACGGGCGCCGGGCN
TGACCNGANAGGGCANATNTNTTGCCTCNTTATAGTGCAGNTTTTCTTTATTGGGTACTCCTCTCTNGAAACACGAGNTG
TTAGAAGACCCAGAGAAAAAAGA
Sequence Type mRNA
Unitrap ID UNI26839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123487126..123487777 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029477 (Morn3) NM_029112 MORN repeat containing 3 Gene [Source:MGI (curated);Acc:Morn3-002]

 
Come back to gene ENSMUSG00000029477


For any suggestions or comments, please send an email to unitrap@crg.es