Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CB0216
Clone ID CB0216
Vector pGT0lxfT1
Project sanger

Sequence tag CB0216
Sequence
CGTCTTTTATTCTTTTTTCATGGAACCCTCGGTAGGATAAGTGTGAGATTGCCGTTGCTGGCTGCCCCTATCTTATTGCC
TCAACATGTTGGTGCACTTATTTCGGTTCGGAATCCGGGGTGGCCCAGTTCCAGGATGGTCGCTACAATCCCTGCGCTTC
CAGACGTTCTCTGCCGCCAG
Sequence Type mRNA
Unitrap ID UNI862

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23900240..23900401 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028973 (Abcb8) NM_029020 ATP-binding cassette, sub-family B (MDR/TAP), member 8 Gene [Source:MGI (curated);Acc:Abcb8-001]

 
Come back to gene ENSMUSG00000028973


For any suggestions or comments, please send an email to unitrap@crg.es