Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF025
Clone ID RRF025
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF025
Sequence
ACCCGGAAGTACTTCTCTGCAGAGGCCTGGGTGACTCTTTTGAATGGAATCGGGCTGATTCATCGCCTGTTCTCCGAGCC
AGGTCCTTGTTGAGTGTGAGGCGCTGCCCTCGCCGCCGCGTCGCCACAAGGCCAGGAGAGAGAGGAAAAACTACTTGTGA
AAAATTGTATCTGCCAGAATTAGCAAGACTTGGAGTTAATAACAAATTTGTCAAATTCAACAAATTGAAGTTTAACACTG
TAAGAATTACAGTTACTGAACAGAAATATGGACAGACTTCTTAGACTTGGAGGAGGTATGCCTGGACTGGG
Sequence Type mRNA
Unitrap ID UNI1569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 61549796..61560814 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026914 (Psmd14) NM_021526 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 Gene [Source:MGI (curated);Acc:Psmd14-001]

 
Come back to gene ENSMUSG00000026914


For any suggestions or comments, please send an email to unitrap@crg.es