Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST91827
Clone ID OST91827
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST91827
Sequence
TGAGCCCATTGAATTTGCATTGAGCCAAGCTTGCCACCAAGAGTCCATCAGTCACCATGATGCTGAGCACAGAGGGCAGG
GAGGGGTTCGTGGTGAAGGTCAGGGGCCTACCCTGGTCCTGCTCAGCCGAGGAAGTGATGCGCTTCTTCTCTGATTGCAA
AATCCAAAATGGCACATCAGGTGTTCGTTTCATCTACACCAGAGAAGGCAGACCGAGTGGTGAAGCATTTGTCGAACTTG
AATCTGAAGATGAAGTGAAATTGGCTTTAAAGAAAGACAGAGAAACCATGGGACACAGATATGTTGAAGTATTCAAATCC
AACAGTGTTGAAATGGTTTGGGTGTTAAAGCAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131139392..131139742 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045427 (Hnrph2) NM_019868 heterogeneous nuclear ribonucleoprotein H2 Gene [Source:MGI (curated);Acc:Hnrph2-001]

 
Come back to gene ENSMUSG00000045427


For any suggestions or comments, please send an email to unitrap@crg.es