Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST91564
Clone ID OST91564
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST91564
Sequence
TAAGGGATCCTGCATTGAACAGAGAAGATGACTACAGAATTGAAAGAGACCATGGGCAGAGCCTCTTGGGACCCANAGAA
GGTGAAAATGGAAGAAGATGATGAAAGTGTCATAAGTCAGGCATCCAGCCAACAAGTGTACTATGAGAACGACAAGGACT
GTGCCCCAGGGGAGGGTCCTTATGGAAGCATCAGTGTATCATAAGATGAGGAAAAGGGTCAGGAAATGTTCCGGGAAATG
GCAGTGGTGCTAAAAGCAACACAGGAGGCTGCTGCTGCTTCACCCTTTGGGAGCTACTCGTTGGCAGGGACTCTGGCCCG
AGAGTCAAATCCTGGAGCTTCATGGGAACCCAACCCCAACAGGTGCCAAAAGCAAGAACCTAGAGTTATTGATTTCCTAA
AAAGGAGATAAGC
Sequence Type mRNA
Unitrap ID UNI20980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122834203..122838766 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057895 (Zfp105) NM_009544 zinc finger protein 105 Gene [Source:MGI (curated);Acc:Zfp105-001]

 
Come back to gene ENSMUSG00000057895


For any suggestions or comments, please send an email to unitrap@crg.es