Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CB0188
Clone ID CB0188
Vector pGT0lxfT1
Project sanger

Sequence tag CB0188
Sequence
CCTCTGCCTATCTTCCCCGGCCTCCGCGTTTCCGGCTCCTGGACTGTCCGCGTGATTTTGAGCGAGTGCTGCAGAGCGGT
ATGCTGTAGGGAGCTGGCGAAGTCTGGGGAGTCGTCCTGGGGATCGGTGCCTCGGTGGACCCTCGGGGCCCCGCGGAGGC
CTGAGGCAGAGTCACTGAAGTTATTGTGAAATTAGTTCCAGACTCCTGACCCTAGGATAACAGCGCACTTATATGAAACC
ATGGCCGGCTATAAACCTGTAGCGATTCAAACATATCCTGTACTTG
Sequence Type mRNA
Unitrap ID UNI864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99030798..99032968 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041747 (Utp15) NM_178918 UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:2145443]

 
Come back to gene ENSMUSG00000041747


For any suggestions or comments, please send an email to unitrap@crg.es