Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF058
Clone ID RRF058
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF058
Sequence
TCCGGGCCGTAGGCCTGACTCCTCAGAGCTGCTGTCATGGCGGGTGCTCTGTGGGGTTTCTTCTCCGTCCTGCTTCTGTT
ATTATCAGGAGATGCCCACAGCTCGGAGGTGCCTGGGGCTGCTGCCGAGGGCCCGGGAGGTAGTGGGGTCGGCCTGGGAG
ATCGTTTTAAGATCGAGGGACGTGCGGTTGTTCCGTGGGTGAAGCCTCAGTACTGGATCTCCTCGGCCCGAGTGCTGGTA
TACGGAGAAGAGCATGTCGGCTTCCTTAAGACAGATGGGAGCTTTGTGGTTCATGATATTCCCTCTGGCTCTTATGTAGT
GGAAGTTATTTCTCCTGCTTACAAGTTTGACCCTGTCCGAGTCGATATCACTTCAAAAGGAAAAATGCGAGCAAGATATG
TGAATTACATCAAAACGTCAGAAGTGGTCAGATTACCCTATCCTCTCCAAATGAAATCTTCAGGTCCACCTTCTTACTTT
ATTAAGAGGGAATCGTGGGGCTGGACAGACTTTCTGATGAACCCAATGGTTATGATGATGGTTCTCCCGTTATTGATATT
TGTGCTTCTGCCTAAAGTGGTGAACACAAGTGATCCTGACATGAGACG
Sequence Type mRNA
Unitrap ID UNI7480

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 112295189..112304973 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055943 (2900064A13Rik) NM_133749 RIKEN cDNA 2900064A13 gene Gene [Source:MGI Symbol;Acc:MGI:1920274]

 
Come back to gene ENSMUSG00000055943


For any suggestions or comments, please send an email to unitrap@crg.es