Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST91285
Clone ID OST91285
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST91285
Sequence
GACTGAGGCCGAACATCTCAATCAGGNGCAGAACATGGACCACAGTGCAGAGAAAGCTGCAGCCAATGCCGAGGTGCCCC
AGGAACTGCTGGAAGAAATGCTTTGGTATTTTCGTGCAGAAGATGCGGCTCCTTGGAATTATTCCATCCTGGTCCTGGCA
GTCCTGGTGGTCATGACAAGCATGTTCCTCCTGAGAAGGAGCATCCTGGCAAACAGAAATCGAAAGAAGCAGCCACAAGA
CCAAGAAACACCAGAAGACCTGCATCTTGATGACTCCATAATGAAAGAGAACAACAGCCAGGTCTTCCTAAGAGAGACAT
TGATCTCAGAGAAACCAGACTTGGCCCCGGGGGAACCTGAGTTGAAAGAGAAAGACTCATCACTTGTCTTTCTGCCAGAC
CCACAGGAAACAGAGAGCTAGGGAGCGTTGAGAGTACCCCATAACGCCCCATAACGCCGCCTAACTTATTTTTAGCAGAC
TCAATAAACAAACTACAATCAGACGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65260516..65263088 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053862 (Ostb) NM_178933 organic solute transporter beta Gene [Source:MGI Symbol;Acc:MGI:3582052]

 
Come back to gene ENSMUSG00000053862


For any suggestions or comments, please send an email to unitrap@crg.es