Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST91097
Clone ID OST91097
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST91097
Sequence
CCTGCCGGAACCAGTAGGCAAATACATCGAATACGACCCTGTTATTATCTTGATTAATGCCATTTTATGCAAAACTCAGG
CCTACAGGCATATTCTTTTCAACACTAAAATAAATGTA
Sequence Type mRNA
Unitrap ID UNI17706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127249160..127249278 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031982 (Arv1) NM_026855 ARV1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916115]

 
Come back to gene ENSMUSG00000031982


For any suggestions or comments, please send an email to unitrap@crg.es