Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST90814
Clone ID OST90814
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST90814
Sequence
TGGCGTGTGGGCACATAGTGACCTCTCAGGACAGTGGCACAATGACATCTAAGAATTATCCAGGGACTTACCCCAATTAC
ACTGTGTGTGAAAAGATCATCACAGTCCCAAAGGGGAAGAGACTTATTCTGAGGTTGGGAGATTTGAACATTGAGTCCAA
GACCTGCGCTTCTGACTATCTCCTCTTCAGCAGTGCAACAGATCAGTATGGTCCATATTGTGGGAGTTGGGCTGTTCCCA
AAGAACTCCGGCTGAACTCAAACGAAGTGACTGTCCTCTTCAAGAGTGGATCTCACATTTCTGGCCGGGGCTTTCTGCTG
ACCTACGCCAGCAGTGACCATCCAGATTTAATAACCTGTTTGGAACGAGGCAGCCATTATTTCGAGGAAAAATACAGCAA
ATTCTGCCCAGCTGGCTGTAGAGACATAGCAGGAGATATTTCTGGGAATACAAAAGATGGTTACAGAGATACCTCTTA
Sequence Type mRNA
Unitrap ID UNI11601

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51981537..52010729 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019891 (Dcbld1) NM_025705 discoidin, CUB and LCCL domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913936]

 
Come back to gene ENSMUSG00000019891


For any suggestions or comments, please send an email to unitrap@crg.es