Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST90588
Clone ID OST90588
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST90588
Sequence
GGCATGCCTGCTGGCTAGCAGTGATCCACATGGCCCAGATTTCAGAGGACAAGCCATATGCANAGCTGTGGATGGGGACA
CACCCCNAGGGGAGATGCCAAGATCCTTTTAAAAGAATA
Sequence Type mRNA
Unitrap ID UNI26859

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57398539..57400017 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032306 (Mpi) NM_025837 mannose phosphate isomerase Gene [Source:MGI Symbol;Acc:MGI:97075]

 
Come back to gene ENSMUSG00000032306


For any suggestions or comments, please send an email to unitrap@crg.es