Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST90571
Clone ID OST90571
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST90571
Sequence
GACTGAGGCCTTATTCAGGATGCTGTGTCGGCTGCTCCTTTGTGAATGTCTGTTGCTGATAACGGGTTATGCTCATGATG
ACGACTGGATTGACCCAACAGATATGCTTAACTATGACGCTGCTTCAGGAACGATGAGGAAATCTCAGGTGAGGTCTGGA
ACATCAGAGAAGAAGGAAGTGAGCCCTGACTCGTCAGAAGCCGAGGAACTGTCAGACTGTTTGCACAGACTGGATTCTTT
AACTCACAAGGTTGATAGTTG
Sequence Type mRNA
Unitrap ID UNI22204

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108464271..108464958 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027884 (Clcc1) NM_145543 chloride channel CLIC-like 1 Gene [Source:MGI (curated);Acc:Clcc1-002]

 
Come back to gene ENSMUSG00000027884


For any suggestions or comments, please send an email to unitrap@crg.es