Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF106
Clone ID RRF106
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF106
Sequence
GATTCCTTTACAGAAGATGCACTTGGCTTACGGTACCCACTGTCTTCTCTCATGTACACAGCTTCCAAGCAATACTTTGA
AAAGTATCCAGGAGATCATGAACTTCTTTGGGAAGTTGAAGGTGTGGGTCACTGGCATCAGCGAGTACCAGTCACCCGAG
CATTGCAGAGAGAGGCTATTAAAGCTACAGATGTTTCTCAATATGAAGCCACAAGACCTGTGTCTGGAGAATATGGTCTT
GCTGCTGTACCAGAACATGAACCTGGACTGGACGACACTCAGTCTAGTGAGCTGCAGATCCATTCCCTAAAAGATGCCTT
TGCTAGCACTTCTGAAGGTCCAGAAAAGACTCCTGTTTCCACGCGTACTCGGAGCAGCCATCTAAAGCGGCCAAAGATTG
GGAAGCGTTTTCAGGATTCTGAGTTTAGTAGTTCTCAAGGTGAAGATGAAAACGTTGCCAAGACTTCACCTACGGCTTCA
GTAAACAAAATAGAGTATGCTGCACGAACATCAGAGAGCTCAGAAGAATTCCTTGAAGAAGAGCCTGAGCAGGGAGTGAT
TGACTTTGAGGATGAAAGCGGTGATAAAGATGCACAGCCTGCTCTGGAAACTCAGCCACGCCTGCAGAAACAAGATGGAG
ACA
Sequence Type mRNA
Unitrap ID UNI8261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97877028..97888484 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es