Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST90445
Clone ID OST90445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST90445
Sequence
GACTGAGATGGAGTCCCCAGTCTCCCCCCAGCGGTGCTGCCACTGCACCTGTTAGTGCCAGTGGTCAATAATGACATCTC
ATCTCCCTGTGAGCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65578918..65579010 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]

 
Come back to gene ENSMUSG00000040524


For any suggestions or comments, please send an email to unitrap@crg.es