Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF130
Clone ID RRF130
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF130
Sequence
CGGCTTTCGGCTCGGAGGAGGCAACGGTGCAACTTTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGCCGCCTC
CACCATGCCGCCCAAGTTCGACCCCAACGAGGTCAAAGTCGTGTACCTGAGGTGCACCGGAGGCGAGGTCGGCGCCACAT
CCGCCTTGGCCCCGAAGATCGGTCCTCTGGGTCTGTCTCCGAAGAAAGTTGGCGATGACATTGCCAAGGCTACCGGTGAC
TGGAAGGGTCTCAGAATTACAGTGAAACTGACCATCCAGAACAGACAGGCCCAGATCGAGGTGGTGCCTTCTGCCTCAGC
CCTGATCATCAAAGCCCTCAAGGAGCCACCGAGAGACAGGAAGAAGCAGAAGAACATTAAACACAGTGGGAACATTACTT
TTGATGAGATTGTCAACATTGCCCGGCAGATGAGACACCGGTCTTTGGCTAGAGAACTTTCTGGAACTATCAAGGAGATC
CTGGGTACTGCACAGTCTGTGGGCTGCAATGTGGATGGCCGCCACCCTCATGACATCATAGATGACATCAACAGTGGTGC
AGTGGAGTGCCCAGCT
Sequence Type mRNA
Unitrap ID UNI869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 29418605..29419180 576
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069682 (AC158592.4) NP_033102 60S ribosomal protein L12 [Source:UniProtKB/Swiss-Prot;Acc:P35979]

 
Come back to gene ENSMUSG00000069682


For any suggestions or comments, please send an email to unitrap@crg.es