Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF154
Clone ID RRF154
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF154
Sequence
TGTGCATCCGTGAGGACCAGACAGTAGATATACAGCCTTCCTACTTGACAGGGAGAAGTTATCCTGTGATGGACTCCAGG
GGGACTCTGGAGGACATGGCCTGGAGGCTGGCGGACGGCGTCATACAGTGTTCATTCAGAAGAAACATCACCCTTCCTGA
GGCTAAGAACAGATTTGTGCTGAATGAGAGCTACTACATATTCTTCGCAGAAGGCCCGTTTCACGACGGCCGAATATTTA
GGCACTCTCAGCAACCTTTGATAACATATGAAAAATACAACGTAACAGACACTCCAAAGAGCGTAGGAGGGTCCCGCTCC
TCACCCCTTTTGAAGGCTCATGGTGCCTTAATGTTTGTGGCATGGATGACCACGGTCAGCATTGGAGTCCTGGTTGCCCG
GTTCTTCAGATCTGTTTGGTCGAAAGCTTTCTTCCTCAGGGAAGCAGCTTGGTTT
Sequence Type mRNA
Unitrap ID UNI8272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116593842..116599708 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033386 (Frrs1) NM_009146 ferric-chelate reductase 1 Gene [Source:MGI Symbol;Acc:MGI:108076]

 
Come back to gene ENSMUSG00000033386


For any suggestions or comments, please send an email to unitrap@crg.es