Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF155
Clone ID RRF155
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF155
Sequence
TGATTAGACGAGTTGTAAATAATGTAAACATTGTTATAAATAATCTCATACTAAAATATGTTGAAGATGACATTGTTCTT
TCTGTCAACATCACTTCAGCTGAAGGGTGGGGGCGCTTTTAAAAAGGGTTTTTTTTTTTTTTTTCTTTTTTAAGCAACTG
ATCTGGTGCTGAGGAAGGCTATCAATTTTTCTGACTGTACAGTTTGTCTCGATAAACGAAATGCTAGTGGCAAAATTGAA
TTTTACCAGGATCCTTTATTGTACAAATGTTCTTTTAGAACTCGCCTGCATTTTACATATGATAACCTAAATTCCAAGAT
GCCATCTGTTATTAAA
Sequence Type mRNA
Unitrap ID UNI8273

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 35352078..35353052 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037646 (Vps13b) vacuolar protein sorting 13B (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916380]

 
Come back to gene ENSMUSG00000037646


For any suggestions or comments, please send an email to unitrap@crg.es