Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF165
Clone ID RRF165
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF165
Sequence
GTTGGTGGCGACCCCGCGGTGGTTGCGGAGATTTGACTGCTGCAAGGCATGGCCCATTTCTCCAGCGAGGATGAGGTGAT
GCTGCAGGCGATGCTCCGGCAGCTGTTCCAGAGCGTGAAGGAGAAAATCACCGGAGCTCCCTCCTTGGAGTGCGCAGAGG
AGATCCTCTTGCGGCTGGAGGAGACTGACGAAAATTTTCACAACTATGAATTTGTGAAATACCTCAGACAGCACATATGT
AACATGTTGGGGTCTATGATTGAAGAAGAAATGGAAAAATGCACATCTGATCAGAATCAGGGGGAGGATTCTGGCTATGA
CACGGTTGTTCAGCATGTTACCAAAAGAACGCAGGAATCTAAAGAGTATAAGGAAATGATGCATTCCCTGAAGAACATTA
TGATGGTGGTGGTCGAGGCGATGATCAACAAGTTTGAGGAAGACGAGACACGGAGTGAGGACAGGCAGAGGAAAATGCAG
AGTGGCAGCTGCTGCACAGACAACTGCTCCGACAGTGACTCCTCCTTCAATCAGAGTTACAAATTCTGTCAAGGGAAACT
ACGGTTGATTTTAGACCAGTTGGATCCTGGCCAACCTAAAG
Sequence Type mRNA
Unitrap ID UNI8278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55921696..55948486 204
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078446 (AC153521.7)  

 
Come back to gene ENSMUSG00000078446


For any suggestions or comments, please send an email to unitrap@crg.es