Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST89338
Clone ID OST89338
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST89338
Sequence
TTGCTGTGGATAGAAGCAACCTTTAAGACCTGTGATGAGAGTTCCTTTTGCAAACNGGCAGCCGAAGCATTCGGCCAGGC
CTCTCTCCTTACCGTGCCTTGCTGGACACTCTGCAGCTTGGTCCTGATGCTCTTACAGTCCATCTGATCCATGAAGTCAC
CAAGGTCAGGCAAGACAAGAAAGAGTGGTAGGGATGGGGAAATGGGTGGTAACTTGGGAAAGAAAAACTTGTAAATAAAT
GTCTTGTGTCAGGCTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI6848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8976807..8977213 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071650 (Ganab) NM_008060 alpha glucosidase 2 alpha neutral subunit Gene [Source:MGI Symbol;Acc:MGI:1097667]

 
Come back to gene ENSMUSG00000071650


For any suggestions or comments, please send an email to unitrap@crg.es