Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF224
Clone ID RRF224
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF224
Sequence
CAGAGCAGCCAAGATGGCCGACTTTGAGGATCGGGTGTCGGATGAAGAGA
Sequence Type mRNA
Unitrap ID UNI7212 UNI7213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 107352547..107352596 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067017 (AC124553.4)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 104667260..104667309 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070372 (Capza1) NM_009797 capping protein (actin filament) muscle Z-line, alpha 1 Gene [Source:MGI (curated);Acc:Capza1-001]

 
Come back to gene ENSMUSG00000070372


For any suggestions or comments, please send an email to unitrap@crg.es