Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST89306
Clone ID OST89306
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST89306
Sequence
CAGAATCTCTTATACTACAGTCAAGACGAGGGAGTCCAAAATAATGATCAGTGACTTTGGCTTGTCGAAAATGGAGGGCA
AAGGAGATGTGATGTCCACGGCCTGCGGGACCCCAGGCTATGTTGCTCCGGAAGTTCTCGCCCAGAAACCGTACAGCAAA
GCTGTGGACTGCTGGTCCATCGGGGTGATCGCCTATATCTTGTAAGTATTGCTTACCACCATGGCTCCCCTCCACCTCTA
CTTATCTGACTGTGGCAAAATATGTGTAACAGAGATTTTTATCGTTCTGGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26875

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5260137..5275837 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039145 (Camk1d) NM_177343 calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI (curated);Acc:Camk1d-001]

 
Come back to gene ENSMUSG00000039145


For any suggestions or comments, please send an email to unitrap@crg.es