Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF234
Clone ID RRF234
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF234
Sequence
ACAGGGCAAAGATGGCGGCGGAGGAGCAGGAGGCGTTGAGGGAGTTCATGGCGGTGACGGGCACTGAGGAGGAAAGGGCT
CGTTTCGTCCTGGAGAAGGCTGGCTGGGACCTG
Sequence Type mRNA
Unitrap ID UNI1000

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 19784735..19784847 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059078 (AC148089.8)  

 
Come back to gene ENSMUSG00000059078


For any suggestions or comments, please send an email to unitrap@crg.es