Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST88770
Clone ID OST88770
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST88770
Sequence
CTGAGTACCGACAGTTCAATGAGGACATGATCCCCACTGTGGGTTTCAACATGCGAAAAATCACCAAAGGGAATGTGACC
ATCAAGCTCTGGGACATTGGGGGGCAGCCCCGTTTCCGAAGCATGTGGGAACGCTACTGCAGAGGAGTGAGCGCCATCGT
GTATATGGTGGATGCTGCGGATCAAAGTGAANATCATGCTGCCCTGNNACCCANGNGGNAANANTGGTNCCANGAAGCCT
TTCGCCTGATCATGNGAGCNTNGNNNANCCTANAGATGAAANCNTGCCCACGACCNCCATCTNCNAACAGNAGGGTGGNA
AGCCANANNCACCAGTCATGCCCCANCCAGTGCCTACAGCATACTCAGTGTCTTGGCAGNTGCATGTGGAGGCATT
Sequence Type mRNA
Unitrap ID UNI26877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 137049052..137050786 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026426 (Arl8a) NM_026823 ADP-ribosylation factor-like 8A Gene [Source:MGI Symbol;Acc:MGI:1915974]

 
Come back to gene ENSMUSG00000026426


For any suggestions or comments, please send an email to unitrap@crg.es