Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST88678
Clone ID OST88678
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST88678
Sequence
AGAGTCTCCTTCAGGCACCATGAAAGCAGTGCTGCGCAAGGCTGGAGGTGCAGTCTCGGGAGAGGAAAAACAGTTCTTGG
AGGTCTGGGAGAAGAACCGCAAGCTCAAGAGTTTCAACCTGTCTGCACTGGAGAAGCATGGGCCTGTGTATGAAGATGAC
TGCTTTCNNTGCNTNTNCTNTTCACANTTCTGNGACTGNACTTNTTGTATAGANGCNNTNAATAANCGTNCCAGCAGCTG
AATCCTTCTTTC
Sequence Type mRNA
Unitrap ID UNI26880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107995138..107995393 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032590 (Apeh) NP_666338 acylpeptide hydrolase Gene [Source:MGI Symbol;Acc:MGI:88041]

 
Come back to gene ENSMUSG00000032590


For any suggestions or comments, please send an email to unitrap@crg.es