Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST88662
Clone ID OST88662
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST88662
Sequence
TGAGTTAGAAGAAGACATGGTTTCCCCCCACTTCCCAGCACGTCTAAGTTTTATCTTTTTTGGGGTCCTTATCTGTTGCC
ACAATGCAACAAGCTGTAGAACAAGCTTTGGATTGCGCAGAGTACATCGTGGAAAGTGCTCAGCAGAGACCTCCTAAAAG
GAAATACCTGTCTAGTGGAAGAAAGTCTATATTTCAAAAACTTTATGACTTATATGTTGAAGAATGTGAAAAAGAACCCG
AGGTTAAGCAGAAATTAAGAAGAAATGTGAACTTGTTAGAGAAGCTTGTTATGCAGGAGACTTTGTCGTGTTTAGTAGTC
AATCTGTACCCAGGAAATGAAGGCTATTCTCTGATGCTCAGGGGGAAAAATGGATCAGGTAAGACCGTATAAAGTATGCC
TGCCACAAAACACCTCTGCTTTTGAAAGTTAGCTCTTAAAAAATTAAAAGTTGACCTTTAATCAGAGTTTATCCTGATTA
AAAGACAAATTCTTATTTATTCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54499047..54505664 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027751 (D3Ertd300e) NM_019995 Protein FAM48A (p38-interacting protein)(p38IP) [Source:UniProtKB/Swiss-Prot;Acc:Q7TT00]

 
Come back to gene ENSMUSG00000027751


For any suggestions or comments, please send an email to unitrap@crg.es