Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST88295
Clone ID OST88295
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST88295
Sequence
TCTGTGTTAAGCTGCTGTCCCAGAGGTGCTGGGCATTATGGGAAATCAGCTGGCTGGTATCGCTCCTTCCCAGATCCTGT
CTGTAGAGAGTTATTTCTCAGACATCCATGACTTTGAGTATGATAAGAGCCTGGGAAGCACTCGGTTTTTTAAAGTCGCT
CGAGCCAAGCACCGGGAAGGATGTGGGCATGGTGACTTTCTTCATGTGCATCTCTGGAGAACTGGCCAGATAGCACAACC
TGGGAGCGCTTGCTGCATGTGGAACGGAGCAGGTGAGAAGTGTAAAAAGGGAAGATGACCCGGCCAGTTATTTTCTATGG
AAATGATTGNAAGCCGTTATGTAAACACACTTTTGTTATTATAAATGCTATTCAAACTCAAGTAAACTCTTATTCAAGC
Sequence Type mRNA
Unitrap ID UNI26884

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105546530..105589978 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032571 (Pik3r4) NM_001081309 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 Gene [Source:MGI Symbol;Acc:MGI:1922919]

 
Come back to gene ENSMUSG00000032571


For any suggestions or comments, please send an email to unitrap@crg.es