Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF281
Clone ID RRF281
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF281
Sequence
GGCGCCGGGCCGCGGGATTGTCAATATTTAAACAGAGCGCATCATGCGTGAGTACAAGCTAGTAGTCCTTGGTTCAGGAG
GCGTGGGGAAGTCTGCTCTGACAGTTCAGTTTGTTCAGGGGATTTTTGTTGAAAAATATGACCCAACGATAGAAGATTCC
TACAGAA
Sequence Type mRNA
Unitrap ID UNI8295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 105548824..105604172 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068798 (Rap1a) NM_145541 RAS-related protein-1a Gene [Source:MGI Symbol;Acc:MGI:97852]

 
Come back to gene ENSMUSG00000068798


For any suggestions or comments, please send an email to unitrap@crg.es