Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST87273
Clone ID OST87273
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST87273
Sequence
GAGCTCCCCAGTAAGAATGGTCAGCTGTCTGCCGTCAATGGTGTAGCTGAACAAGATGATGTCCACGTCCAAGAGGAAAG
CCAGGATGGGCAAGAGGAGGAAGTCACTGTTGAAGATGTTGGACAGAGAGAGTCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5993380..6032800 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es