Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST86936
Clone ID OST86936
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST86936
Sequence
GACTGAGATATTGCGATGATGAGTCCAGAGACAGCTGGGTCTCCAAGTGGCAGCGAGTCAGTAACTTTAAGCCAGGTGTA
TATGCTGTGTCCGTCACTGGTCGCCTGCCCCAAGGAATCGTGCGGGAGCTGAAAAGTCGAGGAGTGGCCTACAAATCCAG
AGACACAGCAATAAAGACCTAGCTAGGTGCAGGCCATAGCATCTTGTTCTTCACTTCTGTACTTGTTTTCTTGTGGAACT
AAACCGTGGGACCCCAAAGACTCCCCGCCCTCCATCTCCGAATCAGCAGACTCCACGAAAGCAGCACATCGGCCTTAAGT
CATCTCACTTTCTCTGCCCACTGGTGAAGTGGGAGTGTCTGGGCGGATTCTCAGAGGCTGTGTCAACAGAGGAAGATGCT
GATTTCCCACCTGTGTTCAGGGTTTTGCCTTTGTCTATGGGCAGGACTTTGGTTCAAATACCAATAAAGCGAGCCTTTGG
AACATA
Sequence Type mRNA
Unitrap ID UNI26905

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 87556302..87557119 374
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020485 (Supt4h1) NM_009296 suppressor of Ty 4 homolog 1 (S. cerevisiae) Gene [Source:MGI (curated);Acc:Supt4h1-001]

 
Come back to gene ENSMUSG00000020485


For any suggestions or comments, please send an email to unitrap@crg.es