Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF345
Clone ID RRF345
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF345
Sequence
TGTGAAGCCCTCCAACATGCTTGTAAACACAGGCGGACAGGTCAAGCTGTGTGACTTTGGCGTGAGCACACAGCTGGTGA
ATTCTATAGCCAAGACGTATGTTGGAACAAATGCTTACATGGCACCAGAAAGAATTTCAGGAGAGCAGTATGGGATCCAT
TGTGACGTGTGGAGCTTAGGAATCTCTTTCATGGAGCTTGCTCTTGGAAGGTTTCCATATCATCAGATTCACAAAAACCA
GGCATCTTTACAAGCCTCTCCAGCTTCTGCAGTGCATTGTTGATG
Sequence Type mRNA
Unitrap ID UNI8307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 63064802..63110993 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058444 (Map2k5) NM_011840 mitogen-activated protein kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1346345]

 
Come back to gene ENSMUSG00000058444


For any suggestions or comments, please send an email to unitrap@crg.es