Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF370
Clone ID RRF370
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF370
Sequence
ATTTACTTTCATCCTACAAAGAGGAGCTCTTGGAGCAGCACCAAGAGAGTGTGAGGATGGGGGTCCTGAAGGGTCTTCTC
ACTCCAATGGAAGCTGTGATTGCAAGACTGGTAGAGCCTGGCTATGTCAGATCAGACCTCCATGCTTTGGTTGTGGCCAG
CTCAGTGCCCTTGTTGTTTAGACTCTTTCTGGAAGCATACCTTCAGGAAGAAAGCCAGTTTCTCTGTTTTCAGGTTCTCC
CCAGGTTGTTTGGCTGCTTGCAGATTTCACACCTGCAGGAGGGGCAGATAGAAGCCCTGTCCCTATCAGATTGGACTACA
GAGCTTCTGGCTATAGAGCAACTGTTAAACTCAGTGGCCACCAGTAACATCTACAATGTGGCTACTGACAGGATTCGGCA
TGCAGAGACACAGTTTCACTTCTACCGCCGTGTGGCTGAGGTGCTGATCAACCATTCACAAGCATCTGTGCCAGCTTGGT
TTCGCTGCCTCAAGATTTTGATCTCTCTGAATCATTTGATTTTAGAGCCAGACCTGGATGACCTGTTGTCTTCGGCTTGG
ATTGATGCGGAAGTAACAGAATTTCGAGCCAAAAAGGCCCAGG
Sequence Type mRNA
Unitrap ID UNI8312

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126552201..126552803 603
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031976 (AK122209) NM_001029876 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2681124]

 
Come back to gene ENSMUSG00000031976


For any suggestions or comments, please send an email to unitrap@crg.es