Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF380
Clone ID RRF380
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF380
Sequence
CCTCTTTTCTCGCCTTGTCCCCTTTGTCCATCGAGAAGGCACCCTGGGCCAGCAGGCCCGTGATGCTCTACTTCTGCTCA
TGGCTCTGTCAGATGGGAGCCCCACTGTGGGCCGCTACATCGCAGATCACTCTTACTTCTGCCCGGTGCTGGCCACAGGG
CTGAGCGCCCTGTACTCCTCACTGCCTCGAAAGATTGAGGTTCCGGGGGATGATTGGCACTGCTTGCGCCGGGAAGACTG
GATAGGAGTGCCTGCCCTTGCACTCTTCATGAGTTCCCTTGAGTTCTGCAATGCAGTCATTCAGGTAGCTCACCCGCTGG
TGCAGAAGCAGCTGGTTGATTATATTCACAATGGTTTCCTGGTGCCTGTCATGGGCCCTGCCCTGCACAAGACCTCTGTG
GAGGAGATGATTGCGAGTACCGCCTACCTGGAACTTTTCCTGCGGAGCATCTCAGAGCCTGCTTTGCTCCGTACCTTCCT
GCGATTCCTGTTGTTACATCGGCATGATACCCACACCATCCTTGACACGCTCGTTGCCCGTATTGGCAGCAACTCCCG
Sequence Type mRNA
Unitrap ID UNI8317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 112536699..112537912 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044465 (4632419K20Rik) NP_950174 family with sequence similarity 160, member A2 Gene [Source:MGI Symbol;Acc:MGI:1921599]

 
Come back to gene ENSMUSG00000044465


For any suggestions or comments, please send an email to unitrap@crg.es