Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF388
Clone ID RRF388
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF388
Sequence
AAAGGTTAAATGAGCTCCCCAGGAATCACCCCAAAAGCAGTGTGGTCATTGAGGAGCTTTCACTGGTGGCGTCACCAACC
CTGAGTCCACGGCAGAGCATGCTGTCCACGCAGAACCAGTATAGCACACTGTCCAAGCCAGCGGCGCTAACCGGTACTTT
GGAAGTTCGTCTTATGGGGTGCCAAGATATCCTAGAGAATGTACCTGGACGGTCAAAAGCAACGTCGGTAGCACTACCTG
GGTGGAGTCCAAGTGACAACAGATCGTCTTTTATGAGCAGAACCAGCAAGAGTAAAAGTGGGAGTAGTCGCAACCTCCTG
AAAACGGATGACTTGTCCAATGATGTTTGTGCTGTTTTGAAGCTAGATAATACTGTGGTTGGTCAAACTAGCTGGAAACC
CATTTCAAATCAGTCGTGGGACCAGAAGTTTACACTGGAACTAGACAG
Sequence Type mRNA
Unitrap ID UNI1197

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 142483502..142491997 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004591 (Pkn2) NP_848769 protein kinase N2 Gene [Source:MGI Symbol;Acc:MGI:109211]

 
Come back to gene ENSMUSG00000004591


For any suggestions or comments, please send an email to unitrap@crg.es