Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRF390
Clone ID RRF390
Vector pGT0Lxf
Project baygenomics

Sequence tag RRF390
Sequence
CACCCAGAAGCTGCTATTGGAGACTGCTGCCCCGAGGGCCCCCTCAAGTAGACGGTACAACGAAGGCAGAGAGCTCAGGT
ATGGATCTTGGAGGGAGCCCGTCAACCCCTACTACGTCAACTCTGGCTATGCCCTGGCCCCAGCCACCAGTGCCAATGAC
AGTGAGCAGCAGAGCCTGTCCAGTGATGCTGACACGCTATCCCTTACGGACAGTAGTGTGGATGGAATCCCCCCATACAG
GATCCGTAAGCAGCACCGAAGGGAGATGCAGGAGAGTATCCAAGTCAATGGGCGGGTACCTCTACCTCACATTCCTCGCA
CTTACCGAATGCCAAAGGAGATCCGGGTAGAGCCACAGAAATTTGCTGAAGAGCTTATTCACCGTCTAGAGGCTGTCCAG
CGCACTCGAGAGGCTGAAGAAAAGTTGGAGGAACGGCTGAAGCGTGTACGCAT
Sequence Type mRNA
Unitrap ID UNI1059

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26280444..26321258 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024182 (Axin1) NM_009733 axin 1 Gene [Source:MGI (curated);Acc:Axin1-001]

 
Come back to gene ENSMUSG00000024182


For any suggestions or comments, please send an email to unitrap@crg.es